SubtiBank SubtiBank
Version comparison:

2019-02-19 20:22:162025-05-13 08:07:12

locus

BSU09420

BSU_09420

outlinks

bsu

BSU09420

BSU_09420

Gene

Phenotypes of a mutant

a ''[[gene|cwlO]] [[gene|lytE]]'' mutant is not viable [Pubmed|17581128,22139507]

growth defect at high temperature [Pubmed|21541672]

inactivation of ''[[gene|lytE]]'' strongly restores beta-lactam resistance in a ''[[gene|sigM]]'' mutant by delaying cell lysis [Pubmed|22211522]

a ''[[gene|lytE]]'' mutation is synthetically lethal with ''[[gene|ftsE]]'' and ''[[gene|ftsX]]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]

a ''[[gene|lytE]]'' mutation increases the cell separation defect of a ''[[gene|lytF]]'' mutant [Pubmed|23855774]

cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]

reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]

a ''[[gene|cwlO]] [[gene|lytE]]'' mutant is not viable [Pubmed|17581128,22139507]

a [[gene|ugtP]] [[gene|lytE]] double mutant has a severe [SW|cell shape] defect, thi can be suppressed by mutations resulting in reduced expression or activity of [[protein|PonA|PbpA]] [pubmed|33087775]

growth defect at high temperature [Pubmed|21541672]

inactivation of ''[[gene|lytE]]'' strongly restores beta-lactam resistance in a ''[[gene|sigM]]'' mutant by delaying cell lysis [Pubmed|22211522]

synthetically lethal with ''[[gene|ftsE]]'' and ''[[gene|ftsX]]'' mutation (due to a lack of autolysin activity) [Pubmed|23869552,23855774]

synthetically lethal with [[gene|sweC]] and [[gene|sweD]], this can be suppressed by point mutations in [[gene|ftsE]] or [[gene|ftsX]] [pubmed|31437162]

a ''[[gene|lytE]]'' mutation increases the cell separation defect of a ''[[gene|lytF]]'' mutant [Pubmed|23855774]

cells are thinner (reduced diameter) as compared to the wild type [Pubmed|23869552]

reduced colony size with accumulation of dead cells in the colonies [pubmed|29114240]

The protein

[SW|Domains]

contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]

C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]

contains three N-acetylglucosamine-polymer-binding [SW|LysM domain]s [Pubmed|18430080]

C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507]

3 [SW|LysM domain]s (aa 26-69, aa 86-129, aa 149-192) (according to UniProt)

Biological materials

Mutant

1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A790&Search=1A790 BGSC]

1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]

1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1024&Search=1A1024 BGSC]

BKE09420 ([[gene|lytE]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09420 BGSC] and in [SW|Jrg Stlke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG

BKK09420 ([[gene|lytE]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG

1A790 ( ''lytE''::''cat''), [Pubmed|9457885], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A790&Search=1A790 BGSC]

1A792 ( ''lytE''::''cat''), [Pubmed|1588906], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A792&Search=1A792 BGSC]

1A1024 ( ''lytE''::''spec''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1024&Search=1A1024 BGSC]

BKE09420 ([[gene|lytE]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09420 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG

BKK09420 ([[gene|lytE]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCTCCCCAAATG, downstream forward: _UP4_TAATTTTTAGAGAAAACCCG

References

Original publications

21261835, 22211522, 16950129, 17581128, 14594841, 9457885, 9573210, 10322020, 24125693, 23199363, 20059685, 14651647, 23869552, 21541672, 22139507, 23855774, 27118079, 25760608, 29114240, 29458655, 29914988, 29458657, 29465029

21261835, 22211522, 16950129, 17581128, 14594841, 9457885, 9573210, 10322020, 24125693, 23199363, 20059685, 14651647, 23869552, 21541672, 22139507, 23855774, 27118079, 25760608, 29114240, 29458655, 29914988, 29458657, 29465029, 31437162, 31808740, 33087775